The Rheb Switch 2 Segment Is Critical for Signaling to Target of Rapamycin Complex 1^*

Reagents

The QuikChange^™ site-directed mutagenesis kit was from Stratagene. pEBG-p70S6k, pCMV5-FLAG-mTOR-(2148–2549), pCMV5-FLAG-LST8, and pcDNA1-FLAG-raptor-(1009–1335) were described previously (13). Anti-FLAG M2 antibody was purchased from Sigma, and anti-p70S6K(phospho-Thr³⁸⁹) was from Cell Signaling; anti-GST antibody was from Santa Cruz Biotechnology, Inc., and the GSH-Sepharose from GE Healthcare. GDP, GTP, and GTPγS were from Sigma. [³²P]Orthophosphate was from PerkinElmer Life Sciences. D-PBS was from Invitrogen.

Generation of Rheb Mutants

Plasmids encoding all mutant versions of Rheb were generated with the QuikChange^™ site-directed mutagenesis kit from Stratagene. Primers were designed to contain the desired mutations, and the mutagenesis was performed following the manufacturer’s instruction. Each mutant was constructed in both the pCMV5-FLAG and pEBG vectors. All mutants were verified by sequencing.

Cell Culture and Transfection

HEK293T cells were grown in Dulbecco’s modified Eagle’s medium (Invitrogen) supplemented with 10% fetal bovine serum (Sigma), 100 units/ml penicillin, and 0.1 mg/ml streptomycin in 10% CO₂ at 37 °C. Transient transfection was performed by the lipofection method with Lipofectamine following the manufacturers’ instructions. Amino acid withdrawal procedures were described as before (14). In the experiments employing RNA interference to knockdown endogenous Rheb in HeLa cells (Fig. 3B), control siRNA or Rheb siRNA was transfected with Lipofectamine 2000. The Rheb siRNA (sequence UCAGUGUAGUUUGUUGUUUAA) targets Rheb 3′-untranslated region; the control siRNA is CACAACUCGCGUGCCGAGUUCAUAA. One day after siRNA transfection, cells were transfected with pCMV5-FLAG vector or pCMV5-FLAG-Rheb WT or mutants. Cells were harvested and analyzed by immunoblot 48 h after plasmid transfection.

Assays of Rheb Function

The assay of the ability of Rheb to signal to TOR complex 1 in vivo involved transient coexpression of FLAG-tagged wild type- or mutant-Rheb with an S6K1 reporter in 293T cells. Two hours prior to harvest, the medium was replaced with D-PBS. Extracts were prepared as in Ref. 13 and subjected to immunoblot for Rheb, S6K1 polypeptide, and S6K1(Thr(P)³⁸⁹). The dose of wild type Rheb chosen was 0.5 μg of DNA, which restores S6K1(Thr(P)³⁸⁹) to 50–70% of maximum. For assays of Rheb guanyl nucleotide binding in vitro, Rheb wild type and mutant polypeptides were transiently expressed as GST fusion proteins in HEK293T cells. Cells were extracted in ice-cold buffer (25 mM HEPES, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0.25% sodium deoxycholate, 10% glycerol, 10 mM MgCl₂, 1 mM EDTA, leupeptin (10 μg/ml), and aprotinin (10 mg/ml)), cleared by centrifugation, and incubated at 4 °C for 1 h with GSH-Sepharose beads. Adsorbed proteins were washed three times in extraction buffer and eluted with 10 mM reduced glutathione in 50 mM Tris, pH 8.

Guanine nucleotide binding was determined as described previously (21). GST fusion Rheb (1.5 μg) was incubated at 30 °C in binding buffer (20 mM Tris, pH 7.4, 50 mM NaCl, 0.1% Triton X-100, 1 mM dithiothreitol, 40 μg/ml bovine serum albumin, 1 mM EDTA, 1 mM MgCl₂, and 2 μM [³⁵S]GTPγS, or [³H]GDP (each at 2 Ci/mmol; PerkinElmer Life Sciences)). At the times indicated, ice-cold wash buffer (20 mM Tris, pH 7.5, 100 mM NaCl, 10 mM MgCl₂, and 1 mM dithiothreitol) was added, and the samples were rapidly filtered through nitrocellulose filters and washed twice with this buffer. The amount of bound guanine nucleotide was measured by scintillation counting. Rheb guanyl nucleotide binding in vivo, protein-protein interactions during transient expression or in vitro, and the assays of mTOR kinase bound to recombinant GST-Rheb were performed as described in Ref. 13.

Generation of Rheb Mutants That Collectively Change All Surface Residues to Alanines

Based on the assumption that surface-exposed amino acid side chains are critical for the interaction of Rheb with its effectors, we undertook to change clusters of solvent-exposed side chains to methyl groups through mutation of contiguous surface residues to alanine. We inferred that the loss of function caused by mutation of residues in the switch I region (by homology, Rheb residues 31–43; see Refs. 13, 18, 20), indicates that, as with Ras (22), the switch 1 region is exposed on the Rheb surface in the GTP-liganded polypeptide in a manner that enables interaction with Rheb effectors. Moreover, we assumed that the residue side chains most highly exposed to solvent in the fully folded Rheb structure were likely to be less critical for proper Rheb folding as compared with buried residues. To identify Rheb residues appropriate for mutation, we examined the recently published human Rheb structure (complexed with either GTP or GDP) (20) with the DeepView program, available at the Swiss Protein Database. The function “accessible amino acids” identifies residues based on their solvent accessibility relative to the solvent accessibility of residue X in an extended pentapeptide GGXGG, whose solvent-accessible surface is set at 100%. Thus at an accessibility setting of 100%, none of the amino acids in the Rheb-GTP structure are considered to have a surface whose solvent accessibility is equal to the solvent accessibility of residue X. To identify probable Rheb surface residues, we therefore reduced the percent of surface accessibility required relative to residue X until the DeepView program identified most of the Rheb switch 1 residues as solvent-accessible; at an accessibility setting of 54%, Ile³⁹ was the first Rheb switch 1 residue to be designated as solvent-accessible, and Asp³⁶ and Gln³⁰ became “accessible” at a setting of 44%. The switch 1 residue Asn⁴¹, whose mutation to alanine was shown previously to result in a partial loss of signaling to TOR complex 1 (13, 18), became solvent-accessible at a setting of 27%. We therefore chose a level of 25% of surface accessibility relative to residue X; at this setting, Rheb amino acids 33–37 and 39–42 are considered by the DeepView program to be solvent-exposed in the Rheb-GTP structure. Overall, 58 of the first 172 Rheb amino acids are solvent-exposed in Rheb-GTP, among which 50 are also exposed in the Rheb-GDP structure; of the eight residues solvent-exposed exclusively in Rheb-GTP, four are in the switch 1 segment. In addition, seven other residues are solvent-accessible only in Rheb-GDP (Fig. 1). The 58 putative solvent-exposed residues in Rheb-GTP were clustered and collectively changed to alanines through a total of 20 mutants that each change 1–5 amino acids (Table 1, class I). As regards the residues that are solvent-exposed only in Rheb-GDP, Ser¹⁶, Thr³⁸, Glu⁵³, and Ser⁷⁵ were individually changed to alanines; Ser⁴ was converted to alanine together with the constitutive surface residues Gln³ and Ser⁶, and Arg¹⁶² and Leu¹⁶⁵ were converted to alanine together with the buried residues Ile^163/164 (Table 1, class II). All mutants were constructed based on two plasmids, pCMV5-FLAG-Rheb and pEBG-Rheb, allowing for expression of FLAG- or GST-tagged Rheb in mammalian cells, respectively. An alignment of human Rheb1 and Rheb2 and the residues that were mutated in Rheb1 are shown in Fig. 1. All Rheb mutants are listed in Table 1.

Of the 26 mutants, only the E94A/K97A mutant is poorly expressed after transient transfection in 293 cells. Further analysis showed that E94A or K97A individually has no effect on Rheb expression or S6K1 rescue; however, changing the Glu⁹⁴ and Lys⁹⁷ residues simultaneously (to Ala or Met) appears to have structural consequences that lead to low expression, presumably because of misfolding (data not shown). This mutant is excluded from further analysis. The other 25 mutants are well expressed (Fig. 2A).

Identification of Partial and Severe Loss-of-Function Rheb Mutants

Withdrawal of extracellular amino acids from 293 cells for 90–120 min leads to complete but reversible dephosphorylation of S6K1(Thr^389/412) (15). Transient overexpression of wild type Rheb can, in a dose-dependent and rapamycin-sensitive manner, restore S6K1(Thr³⁸⁹) phosphorylation in amino acid-deprived cells, indicating that Rheb achieves this rescue through TORC1 (14). We therefore utilized this response to Rheb to assess the ability of the Rheb alanine mutants to signal to TORC1 in vivo. Inasmuch as we sought to identify strong loss of function mutants, a dose of wild type Rheb capable of ~50–70% of the maximal S6K1(Thr³⁸⁹) phosphorylation (14) was chosen for the comparison.

As illustrated by Fig. 2A, the comparison of the mutants to wild type Rheb was carried out only in experiments where the expression of the mutant Rhebs was equal or only slightly (i.e. less than 2-fold) greater than that of wild type Rheb, with the exception of the E94A/K97A mutant described above. The results of a series of three or more such comparisons are summarized in Fig. 2B; essentially, the vast majority of the Rheb alanine mutants are functionally “normal” in this assay, i.e. their ability to rescue S6K1(Thr³⁸⁹) phosphorylation from amino acid withdrawal is within 2 standard deviations of that exhibited by comparable expression of a half-maximal dose of wild type Rheb (whose effect is set arbitrarily in Fig. 2B to 100%). Two mutants, Y67A/I69A and I76A/D77A, show a severe defect, essentially a complete inability to rescue S6K1 from amino acid withdrawal. These inactivating mutations are located in the switch 2 region, flanking the short helix, amino acids 72–74. The surface residue mutants Q72/T73A and S75A are normal in their ability to restore S6K1(Thr(P)³⁸⁹), whereas the mutant Q72A/Y74A (not shown), which changes both a surface residue (Gln⁷²) and an adjacent, solvent-inaccessible residue (Tyr⁷⁴), is completely unable to rescue S6K1(Thr(P)³⁸⁹) despite robust expression.

When examined in amino acid-replete 293 cells, the Rheb(Y67A/I69A) and (I76A/D77A) mutants coexpressed with S6K1 do exhibit an ability to stimulate S6K1(Thr³⁸⁹) phosphorylation, with an efficacy approximately half that of wild type Rheb (Fig. 3A). Thus, these switch 2 mutants do not act in a dominant interfering manner but exhibit a reduced potency that is exaggerated by amino acid depletion. This contrasts with the inactive, nucleotide-deficient Rheb1 mutants S20N and D60I, which cause a modest inhibition of S6K1(Thr³⁸⁹) phosphorylation in replete medium (13, 23). To examine the responses to lower levels of recombinant Rheb in nutrient-replete cells, we reduced endogenous Rheb1 in replete HeLa cells using RNA oligonucleotides directed against Rheb1 3′-untranslated sequences; this results in a substantial reduction in endogenous Rheb1 polypeptide and a partial reduction in the phosphorylation of endogenous S6K1 on Thr³⁸⁹ (Fig. 3B, compare lane 1 with lane 2). On this background, modest overexpression of recombinant, wild type Rheb1 is sufficient to restore S6K1(Thr(P)³⁸⁹) to control levels (Fig. 3B, compare lane 4 to lane 1), whereas comparable overexpression of Rheb1 Y67A/I69A and I76A/D77A yields little or no restoration of S6K1(Thr(P)³⁸⁹) (Fig. 3B, compare lanes 3 and 6 with lane 4). Nevertheless, a higher level of Rheb1 Y67A/I69A expression does significantly restore S6K1(Thr(P)³⁸⁹) (Fig. 3B, compare lanes 5 and 3 with lane 1). Thus, although the ability of these Rheb switch 2 mutants to activate mTORC1 signaling is greatly reduced in amino acid-deprived cells (Fig. 2), they clearly exhibit partial agonist activity in nutrient-replete cells (Fig. 3, A and B). The reduced efficacy of these mutants in amino acid-deficient cells is likely due in part to the ability of amino acid depletion to reduce the interaction between Rheb and mTOR (14), an effect that is also observed with these switch 2 mutants (data not shown).

The Rheb1 mutant E28A/N30A shows a partial (~50%) loss of function that is statistically distinguishable from the response to wild type. E28A/N30A, located immediately amino-terminal to the switch I region, corresponds to nucleotide-invariant residues in Ras whose mutation impairs the transforming activity of Ras (24). Surprisingly however, two mutants that directly alter the Rheb switch I domain, Asp³³-Ser³⁴-Tyr³⁵-Asp³⁶-Pro³⁷-Ala₄, and Ile³⁹-Glu⁴⁰-Asn⁴¹-Thr⁴²-Ala₄, show no loss or only slight loss in their ability to rescue S6K1 from amino acid withdrawal-induced dephosphorylation. This is in contrast to the previous finding that the single mutation of the surface-exposed residue Asn⁴¹ reduces and I39K abolishes the Rheb rescue of S6K1 from dephosphorylation. It appears that the alanine mutations of the switch 1 segment are only modestly disruptive to the interaction of Rheb with its relevant effector(s) as reflected in this assay of Rheb function; the minimal effects of the switch 1 Ala mutants observed in these studies in comparison with the severe inhibition caused by the switch 2 Ala mutants emphasize the critical functional role of the switch 2 surface residues Y67A/I69A and I76A/D77A.

The Rheb1 residues Tyr⁶⁷-Ile⁶⁹ are conserved in Rheb2 (Fig. 1) as well as in Drosophila and S. pombe Rheb. In contrast, Rheb1 Ile⁷⁶, although conserved in Rheb2 and S. pombe Rheb, is Met in Drosophila Rheb, and Rheb1 Asp⁷⁷ is Gly in Rheb2 and S. pombe Rheb. We therefore inquired as to whether Ala mutations at these sites in Rheb2 affect its ability to signal to TORC1 (Fig. 3C). In amino acid-deprived cells, Rheb2 Y67A/I69A is completely unable to restore S6K(Thr³⁸⁹) phosphorylation, whereas Rheb2 I76A/G77A activity, although impaired, is less defective than the corresponding Rheb1 mutant. As with the Rheb1 switch 2 mutants, both Rheb2 switch 2 mutants continue to show partial activity in amino acid-replete cells.

We also examined the function of Rheb mutated at residues more solvent-exposed in the GDP-liganded than in the GTP-liganded structure (Fig. 2B). The T38A mutant exhibited a severe loss of function, as observed previously for T38M (13, 18). Thr³⁸ participates in the coordination of Mg²⁺ and the γ-PO₄ of GTP and undergoes a major flip inward in the Rheb-GTP structure (20). The Arg¹⁶²-Ile¹⁶³-Ile¹⁶⁴-Leu¹⁶⁵-Ala₄ mutation causes a partial loss of function, accompanied by a marked upshift of the slower of the two polypeptide bands of transiently expressed Rheb seen on SDS-PAGE (Fig. 2A, lane 36). This mutant may undergo an aberrant carboxyl-terminal modification which, while having little effect on abundance, may underlie its diminished function. The mutants Asp³³-Ser³⁴-Tyr³⁵-Asp³⁶-Pro³⁷/Ala₅ (Fig. 2A, lane 8) and Thr⁴⁸-Asn⁵⁰-Gly⁵¹/Ala₃ (Fig. 2A, lane 11), whose signaling is unimpaired, also exhibit a slowed mobility on SDS-PAGE, the basis for which is unknown. Gln³-Ser⁴-Ser⁶/Ala₃ and the Ala mutants at Ser¹⁶, Glu⁵³, and Ser⁷⁵ each rescued S6K1(Thr³⁸⁹) phosphorylation in a manner indistinguishable from wild type Rheb.

Guanyl Nucleotide Binding of the Rheb Mutants

We sought next to characterize the biochemical properties of the Rheb mutants, seeking especially an explanation for the severe loss of function of the switch 2 mutants. We tested the ability of the loss of function mutants, Y67A/I69A and I76A/D77A, to bind to GTP. Wild type Rheb and the mutants were expressed in 293T cells, purified, and examined for their ability to bind [³⁵S]GTPγS in vitro; the rate and extent of [³⁵S]GTPγS binding by these mutants were similar to wild type Rheb (Fig. 4A). All of the other Rheb alanine mutants were also examined in this assay (data not shown); although a few of the Rheb alanine mutants exhibited rates of [³⁵S]GTPγS binding in vitro that were reduced by up to 75% as compared with wild type Rheb, all nevertheless exhibited greater binding of [³⁵S]GTPγS than the Rheb mutants S20N and D60I (the latter shown previously to have no ability to bind GTP in vitro or in vivo and to be inactive in rescue). Moreover, none of the Rheb mutants with moderately diminished [³⁵S]GTPγS binding in vitro exhibited significantly reduced ability to rescue S6K1 from dephosphorylation during transient expression (Fig. 2, A and B), perhaps reflecting the level of expression chosen for the assay of their signaling ability.

We also examined the GTP/GDP content of the Y67A/I69A and I76A/D77A mutants during transient expression in 293T cells (Fig. 4B). Overexpression of Rheb was shown by Im et al. (25) to increase the fractional GTP charging compared with endogenous Rheb, perhaps because of exceeding the capacity of endogenous Rheb-GAP activity. In the current experiments transiently expressed GST-Rheb binds guanyl nucleotides at levels 5–20-fold over background, reflecting the expression level of the Rheb polypeptides, except for Rheb1 D60I, which binds no nucleotide as shown previously (13). The GST-RhebY67A/I69A and I76A/D77A mutants each exhibit robust guanyl nucleotide binding and a fractional binding of GTP that exceeds that of wild type Rheb expressed in parallel (Fig. 3B). Thus it is certain that the inability of these mutants to restore S6K1 phosphorylation during transient expression is not attributable to defective GTP charging.

Binding of Rheb Mutants to TORC1 Components

Recombinant Rheb can bind to TOR complex 1, both in vivo during transient expression and directly in vitro (13). Rheb binds to the amino-terminal lobe of the mTOR catalytic domain (2148–2300) and can also bind directly in vitro to mLST8 and to the carboxyl-terminal WD propeller segment of raptor. Several of the inactive Rheb mutants we examined previously were unimpaired in their binding to mTOR, and the nucleotide-deficient, inactive mutants S20N and D60I exhibited a substantially stronger binding to mTOR than wild type Rheb. Conversely, Tee et al. (18) reported that the hypoactive switch 1 mutant N41A exhibited a diminished ability to bind endogenous mTOR, and we found that the inactive Rheb switch 1 mutant I39K exhibits a greatly diminished ability to associate with endogenous mTOR during transient expression as well as a diminished association with the carboxyl-terminal fragment of mTOR, amino acids 2148–2549 (13), although its association with LST8 is similar to wild type Rheb.⁴ Thus nucleotide-deficient inactive Rheb mutants exhibit increased binding to mTOR, whereas some but not all (e.g. T38M) (13, 18) loss of function switch 1 mutants exhibit diminished binding to mTOR. We examined the ability of the Rheb alanine mutants to bind directly to the components of TOR complex 1; because of the difficulty in achieving uniform polypeptide expression during transient cotransfection, we examined the binding in vitro, using equal amounts of purified, immobilized GST-Rheb polypeptides, charged in vitro with GMPPNP, and the individual FLAG-tagged TORC1 component immunopurified after transient expression in 293T cells. As shown in Fig. 5A, purified mTOR-(2148–2549), mLST8, and raptor-(1009–1335) each binds specifically to purified GST-Rheb in vitro. The amount of each of these TORC1 components retained by each of the GST-Rheb-GMPPNP mutants, relative to that retained by wild type GST-Rheb-GMPPNP, is shown in Fig. 5B. The inactive mutants RhebY67A/I69A (Fig. 5B, lane 12) and I76A/D77A (Fig. 5B, lane 15) are unimpaired in their ability to bind to each of the TORC1 components; in fact these mutants bind ~2-fold greater amounts of mTOR-(2148–2549) than does wild type Rheb, and none of the other Rheb alanine mutants bind greater amounts of mTOR-(2148–2549) than do Rheb(Y67A/I69A) and -(I76A/D77A). By contrast the ability of Rheb(Y67A/I69A) and -(I76A/D77A) to bind mLST8 and raptor-(1009–1335) is indistinguishable from wild type Rheb. The modestly enhanced association of Rheb(Y67A/I69A) and (I76A/D77A) with the mTOR-(2148–2549) as compared with wild type Rheb is also evident when these components are transiently coexpressed (Fig. 5C), and is reflected as well in the ability of these Rheb variants to retrieve endogenous, full-length mTOR during transient expression (Fig. 5D). Thus the loss of function of these mutants is not attributable to a deficient interaction with TOR complex 1. The significance of the modestly enhanced association of Rheb(Y67A/I69A) and Rheb(I76A/D77A) with mTOR in relation to their loss of function is unclear; this behavior is similar to but much less pronounced than the enhanced binding of the inactive, nucleotide-deficient Rheb mutants S20N and D60I to the mTOR catalytic domain (e.g. see Fig. 6B) (13). Moreover, as observed with wild type Rheb and all Rheb mutants previously examined (14), the ability of Rheb(Y67A/I69A) and Rheb(I76A/D77A) to bind mTOR is greatly diminished by amino acid withdrawal (data not shown). This likely explains, in part, why the partial agonist activity of these mutants evident in nutrient-replete cells (Fig. 3, A and B) is not readily observed in amino acid-deficient cells (Fig. 2, A and B).

It should be noted that in no instance did a Rheb alanine mutant with retained signaling activity in vivo exhibit a substantial (e.g. >50%) decrease in binding to mTOR-(2148–2549) or to raptor-(1009–1330). Consequently, these results neither support nor refute the functional importance of the direct interaction between Rheb and mTOR or raptor for Rheb signaling in vivo. In contrast, there are several Rheb alanine mutants that are active in vivo but show little or no ability to bind mLST8 in vitro, most notably Rheb-(Q154A/D158A/R161A) (Fig. 5B, lane 23). This behavior indicates that the direct binding of Rheb to mLST8 in vitro is irrelevant to Rheb regulation of TORC1 in vivo and is likely of no physiologic significance.

mTOR Polypeptides Bound to the Inactive Rheb Mutants Y67A/I69A and I76A/D77A Retain Kinase Activity in Vitro

Although the inactive nucleotide-deficient Rheb mutants S20N and D60I bind endogenous and recombinant mTOR more strongly than does wild type Rheb, we observed previously that the mTOR polypeptides bound to S20N and D60I exhibit essentially no kinase activity when assayed in vitro using 4E-BP or a fragment of S6K1 (13). We therefore examined the kinase activity of mTOR polypeptides retrieved with the inactive Rheb mutants Y67A/I69A and I76A/D77A. As shown in Fig. 6, the mTOR polypeptides recovered with these two Rheb mutants exhibit protein kinase specific activity that is nearly equal to that of mTOR retrieved with wild type Rheb, and substantially greater than that of the mTOR bound to the RhebD60I (Fig. 6). Thus, the loss of signaling function shown by the RhebY67A/I69A and I76A/D77A mutants is not explained by an inability to enable mTOR to acquire protein kinase activity in vivo.

Mutations That Render S. pombe Rheb-hyperactive Do Not Alter the Ability of Human Rheb to Overcome the Dephosphorylation of S6K1(Thr³⁸⁹) Caused by Amino Acid Depletion

Loss of Rheb function renders S. pombe (as well as S. cerevisiae) hypersensitive to canavanine toxicity (3), presumably because of increased canavanine uptake, and Rheb overexpression confers canavanine resistance. Urano et al. (19) generated a library of random S. pombe rhb1 mutants and expressed these or wild type Rheb in a strain lacking the chromosomal rhb1 gene. They identified Rheb single amino acid mutants at four residues (V17A or V17K; S21G or S21I; K120R; N153S or N153T) that conferred resistance to canavanine toxicity not engendered by comparable expression of wild type Rheb; these Rheb mutants were presumed therefore to be hyperactive. They observed that a representative Rhb1 mutant at each of these four residues exhibited relatively normal GTP but greatly diminished GDP binding in vitro, and Rhb1K120R, expressed at near physiologic levels, exhibited greatly enhanced association with SpTOR after cell disruption. Impelled by these results, we examined the ability of Rheb V17A, S21G, and S21I, K120R and N153S and N153T to rescue S6K1 from amino acid-induced dephosphorylation; two doses of each mutant were compared with wild type Rheb, the latter at a dose chosen to enable 30% of maximal rescue, so as to readily detect hyper-active mutants. In no instance were these mutants found to be more potent than an equivalent amount of wild type Rheb in the restoration of S6K1(Thr(P)³⁸⁹) (Fig. 7). Whether this reflects qualitative differences between the present assay and that employed by Urano et al. (19) or simply the greater sensitivity of the latter is unclear.