Constitutively Active Inflammasome in Human Melanoma Cells Mediating Autoinflammation via Caspase-1 Processing and Secretion of Interleukin-1β^*

Chemicals and Reagents

Caspase inhibitors (Z-VAD-FMK, Z-YVAD-FMK, and Z-WEHD-FMK) were obtained from Alexis Biochemicals (San Diego, CA), and IL-1Ra (anakinra, Kineret®) was purchased from Amgen, Inc. (Thousand Oaks, CA). Lipopolysaccharide (LPS), phorbol 12-myristate13-acetate (PMA), and muramyl dipeptide were purchased from Sigma-Aldrich. Recombinant human IL-1α was from eBioscience (San Diego, CA). Protein G-Sepharose beads were purchased from Invitrogen.

Antibodies

Anti-caspase-5 antibody (ab17825, rabbit polyclonal) was obtained from Abcam, Inc. (Cambridge, MA). Anti-human IL-1β antibody (affinity-purified goat polyclonal) and anti-caspase-1 p20 antibody (2225, rabbit polyclonal) were purchased from R & D Systems (Minneapolis, MN) and Cell Signaling Technology, Inc. (Danvers, MA), respectively. Anti-ASC antibody (rabbit polyclonal), anti-NALP1 antibody (mouse monoclonal) and anti-NALP3 antibody (mouse monoclonal) were from Alexis Biochemicals. Horseradish peroxidase-conjugated secondary antibody (anti-mouse IgG) was purchased from Jackson ImmunoResearch Laboratories, Inc. (West Grove, PA), and horseradish peroxidase-conjugated secondary antibodies (anti-rabbit IgG and anti-goat IgG) were from Sigma-Aldrich.

Cell Culture

Human melanoma cell lines were obtained from the American Type Culture Collection (Manassas, VA). They were established from different stages of disease progression in the laboratory of Dr. Meenhard Herlyn (Wistar Institute, Philadelphia, PA) with the exception of A375. WM35 and WM1552C are from “early stage melanoma” such as radial growth phase (RGP). Patients were cured by surgical removal of these primary lesions. Others are metastatically competent melanomas, either from “intermediate stage melanoma” such as vertical growth phase (VGP) primary tumors whose patients developed metastasis later (WM75, WM115, WM278, and WM793B) or from “late stage melanoma” such as distant metastasis (A375, HS294T, and 1205Lu). Melanoma cells were maintained in RPMI 1640 (Mediatech, Inc., Manassas, VA) (except HS294T) or Dulbecco's modified Eagle's medium (Mediatech, Inc.) (for HS294T) supplemented with 10% fetal bovine serum (Mediatech, Inc.), 100 units/ml penicillin, 0.1 mg/ml streptomycin, and 2 mm l-glutamine.

The THP-1 cell line (derived from an acute monocytic leukemia patient) was differentiated with 50 nm (31 ng/ml) PMA for 24 h before each experiment. Human umbilical vein endothelial cells (HUVECs) (Astarte Biologics, Redmond, WA) were maintained in growth medium (catalog number 2015; Astarte Biologics).

Clinical Melanoma Specimens

Human melanoma tissues were obtained from surgical specimens with patient consent under institutional review board-approved protocols, adhering to Health Insurance Portability and Accountability Act regulations. The tumors were processed for histological and biological analyses.

Immunohistochemistry

Immunohistochemical studies were performed on formalin-fixed paraffin embedded tissues using a goat polyclonal antibody against human IL-1β (R & D Systems). Briefly, 4-μm-thick paraffin sections were deparaffinized and hydrated. Heat-induced antigen retrieval was performed in 0.01 m citrate buffer (Antigen retrieval citra solution; BioGenex Laboratories, San Ramon, CA). The sections were treated with 0.3% hydrogen peroxide to block endogenous peroxidase activity and incubated with 10 μg/ml of primary antibody for overnight at 4 °C, followed by biotinylated donkey anti-goat IgG for 30 min and ABComplex/horseradish peroxidase avidin-biotinylated peroxidase complex (Vector Laboratories) for 30 min. The immunoreactants were visualized with diaminobenzidine substrate. Hematoxylin (Sigma-Aldrich) was used for counter staining.

Clinical Sample Preparation

Human tumors were minced into small pieces (∼2 mm³). Single cell suspensions were generated by enzymatic digestion with 2 mg/ml collagenase (Sigma-Aldrich) and 2 mg/ml hyaluronidase (Sigma-Aldrich) for 2 h at 37 °C with intermittent vortex, followed by sequentially passing through 70- and 40-μm filters. Red blood cells were lysed using 1× red blood cell lysis buffer (eBioscience). Dead cells were removed with a dead cell removal kit (Miltenyi Biotec, Auburn, CA). The cells were washed and subjected to biological analyses including ELISA and Western blotting.

Cytokine Production and Cytokine Determinations

The cells were cultured in OptiMEM (Invitrogen) at 80% confluence. After 24 h, the supernatants (secreted IL-1β) were collected and centrifuged at 210 × g for 5 min. Intracellular IL-1β was assessed by lysing cells with 0.5% Triton X-100 in phosphate-buffered saline. The lysate was then subjected to a freeze-thaw cycle followed by centrifugation at 15,000 × g for 10 min at 4 °C.

Supernatants and cell lysates were analyzed by ELISA for IL-1β, IL-1α (R & D Systems), and IL-8 (CXCL8) (eBioscience). Nunc Maxisorp ELISA plates (Nalge Nunc International) were used. The limits of sensitivity were 1–2, 3.9, and 7.8 pg/ml for IL-1β, IL-1α, and IL-8, respectively. They were also analyzed by a multiplex antibody bead kit for IL-6, IL-8, and monocyte chemotactic protein-1 (MCP-1; CCL2; Invitrogen). The limits of sensitivity were 3 (IL-6), 3 (IL-8), and 10 pg/ml (MCP-1).

Lactate Dehydrogenase Cytotoxicity Assay

Cytotoxicity was determined by CytoTox 96 assay kit (Promega, Madison, WI) and calculated as follows: % cytotoxicity = 100 × (experimental lactate dehydrogenase (LDH) − spontaneous LDH)/(maximum LDH − spontaneous LDH).

Western Blotting Analysis

The cells were lysed on ice in lysis buffer (10 mm Tris-HCl, pH 7.4, 150 mm NaCl, 5 mm EDTA, 0.2% Nonidet P-40) supplemented with protease inhibitor mixture (Roche Applied Science) and centrifuged at 15,000 × g for 10 min at 4 °C. Protein concentration was determined by Bio-Rad protein assay kit (Bio-Rad).

The lysates were mixed with SDS sample buffer and heated to 90 °C for 5 min. The proteins were separated by electrophoresis on SDS-PAGE gels and transferred onto polyvinylidene difluoride membranes (0.4 μm) in 25 mm Tris, 192 mm glycine, and 20% methanol at 60 V for 1.5 h. The blots were incubated with primary antibodies at 4 °C overnight followed by the incubation with secondary antibodies. The blots were then developed with horseradish peroxidase substrate (West Femto Solution; Pierce) for 5 min at room temperature and analyzed using GelDoc 200 (Bio-Rad).

Immunoprecipitation

The cells were suspended in lysis buffer (50 mm Tris, pH 7.8, 150 mm NaCl, 0.1% Nonidet P-40, 5 mm EDTA) supplemented with protease inhibitor mixture (Roche Applied Science). The lysates were agitated with 5 μg of anti-ASC antibody for 2 h at 4 °C and mixed with protein G-Sepharose beads (20 μl of 50% slurry) overnight at 4 °C on a shaker. The beads were washed three times with lysis buffer, then mixed with SDS sample buffer, and heated to 90 °C for 5 min followed by SDS-PAGE. The samples were blotted onto polyvinylidene difluoride membranes and then probed with antibodies.

siRNA Transfection

siRNA duplexes targeting ASC (Hs_PYCARD_5, CGGGAAGGTCCTGACGGATGA, and Hs_PYCARD_1, CAGCCTGGAACTGGACCTGCA) and scrambled siRNA for nonspecific gene silencing were from Qiagen. Transfection of siRNA duplexes (2 nm) was carried out using HiPerFect transfection reagent (Qiagen) according to the manufacturer's recommendations. After 24 h, the medium was replaced to OptiMEM (300 μl), and the cells were incubated for additional 24 h. The supernatants and cell lysates were collected for ELISA analysis and Western blotting analysis, respectively.

Generation of Melanoma Conditioned Medium and Its Effects on THP-1 Cells

Melanoma conditioned media (MCM) were obtained from supernatants of human melanoma cells after 24 h of cultivation in OptiMEM and centrifuged at 210 × g for 5 min. THP-1 cells, seeded at 80% confluence, were cultured in MCM for 24 h, and the cell lysates were subjected to ELISA analysis.

Chemotaxis Assay

QCM^TM Chemotaxis cell migration assay (Millipore, Temecula, CA) was used. 1205Lu MCM was obtained after 24 h of cultivation of 1205Lu cells in serum-free RPMI 1640 and added to serum-free RPMI 1640 in the feeder tray (lower well). THP-1 cells in serum-free RPMI 1640 were placed into migration chamber and cultured for 2 h. The cells that migrated to the underside or through the membrane were mixed with lysis buffer/CyQuant GR dye solution (Millipore), incubated at room temperature for 15 min, and analyzed with a fluorescence plate reader using a 480/520-nm filter set.

Tube Formation Assay

HUVECs suspended in MCM-containing serum-free M199 medium were cultured for 17 h on polymerized growth factor-reduced Matrigel (BD Biosciences, Bedford, MA). They were fixed in 4% (v/v) paraformaldehyde (Fisher) for 10 min at room temperature and visualized under microscope (40× magnification). The number of tube-like structures with closed networks of vessel-like tubes was counted by two observers independently.

Data Analysis

All of the experiments were replicated at least thrice. The results were analyzed by Student's unpaired t test to compare two groups. One-way analyses of variance followed by Student-Newman-Keuls tests were used to compare multiple groups. The data are presented as the means ± S.E., and differences were considered significant if p < 0.05.

Late Stage Human Melanoma Cell Lines Constitutively Synthesize and Secrete IL-1β

We analyzed the lysates and supernatants of nine human melanoma cell lines. Three metastatic (A375, HS294T, and 1205Lu) and one VGP (WM793B) melanoma cell lines were found to synthesize and secrete IL-1β (Fig. 1A). However, IL-1β secretion was not detectable in two VGP (WM278 and WM75) melanoma cell lines despite the presence of intracellular IL-1β. Neither IL-1β synthesis nor secretion was detected in one VGP (WM115) and two RGP (WM35 and WM1552C) melanoma cell lines. LDH levels in the supernatant were low, confirming that the release of IL-1β was not caused by cell death. To explore the molecular mechanisms responsible for secretion of IL-1β in melanoma, we selected two metastatic melanoma cell lines that secrete IL-1β, 1205Lu and HS294T cells, for further study.

IL-1 Stimulates IL-1β Synthesis and Release in Human Metastatic Melanoma Cells, 1205Lu and HS294T

We examined the ability of TLR4 ligand (LPS) and IL-1 itself to stimulate IL-1 synthesis and release. Human recombinant IL-1α was used to measure the levels of endogenous IL-1β. PMA-primed THP-1 cells were used as a control. 1205Lu, HS 294T, and THP-1 cells synthesized and secreted IL-1β spontaneously, and the synthesis and secretion were significantly enhanced by the stimulation (Fig. 1B). LDH levels revealed that increased IL-1β release was not the result of increased cell death. For melanoma cells, IL-1α was more effective as a stimulant of IL-1β compared with LPS, whereas LPS was more effective for monocytic cells.

IL-1β-secreting Melanoma Cells Contain Components of an Active Inflammasome

To determine whether the inflammasome pathway is utilized in IL-1β secretion mechanisms in human melanoma cells, we first examined the expression of inflammasome components. Western blotting analysis revealed the expression of each component of the inflammasome in 1205Lu and HS294T cells (Fig. 2A). When stimulated with IL-1α, the synthesis of pro-IL-1β (31-kDa form) was increased. However, the levels of the inflammasome components were unchanged, suggesting that 1205Lu and HS294T cells contain constitutive inflammasome components without additional stimulation.

Inflammasome Is Assembled and Activated in IL-1β-secreting Melanoma Cells

ASC is required for NALP3 activation of caspase-1. To further explore the ASC interaction with NALP3, we immunoprecipitated ASC in cell lysates. PMA-primed THP-1 cells were used as a positive control. Immunoprecipitation revealed co-precipitation of NALP3 with ASC in THP-1, 1205Lu, and HS294T cells (Fig. 2B). NALP3 inflammasome assembly was detected even without IL-1α stimulation, suggesting that inflammasome is assembled constitutively in 1205Lu and HS294T cells.

We then examined the cleavage and activation of caspases in 1205Lu and HS294T cells. Activated (cleaved) fragments of caspase-1 (p20) and caspase-5 (p20) were observed in the lysates of 1205Lu and HS294T cells without IL-1α stimulation (Fig. 2C). These data demonstrate that the inflammasome is assembled and activated constitutively, resulting in activation and cleavage of caspases in IL-1β-secreting human melanoma cells.

Melanoma Inflammasome Is Functional and Regulates IL-1β Secretion

We next used siRNA to silence ASC. Scrambled siRNA served as a control. Knockdown of ASC resulted in 70 and 93% reduction of IL-1β secretion compared with control siRNA in 1205Lu and HS294T cells, respectively (Fig. 3A).

To investigate whether IL-1β secretion from melanoma cells requires active caspase-1 and -5, caspase inhibitors were used in cultures of unstimulated as well as stimulated cells. As shown in Fig. 3B, spontaneous and stimulated secretion of IL-1β were reduced by the pan-caspase inhibitor (Z-VAD), caspase-1, 4 inhibitor (Z-YVAD), or caspase-1, 4, 5 inhibitor (Z-WHED). Slight cell death was observed at base line and after caspase inhibition in these cells. These data indicate that inflammatory caspases (caspase-1 and -5) are necessary for releasing IL-1β in human melanoma cells.

Melanoma-derived IL-1β Is Biologically Active Inducing Production and Secretion of Other Cytokines and Chemokines from Melanoma Cells

Because both inactive IL-1β (uncleaved pro-IL-1β) and active (cleaved) IL-1β can be detected by IL-1β ELISA, we determined whether IL-1β secreted from melanoma cells is biologically functional. IL-1Ra was used to block the IL-1R, and as shown in Fig. 4A, there was a reduction of IL-1β synthesis (95% reduction) and release (79% reduction) in 1205Lu cells. These data suggest that active IL-1R signaling is responsible for constitutive IL-1β synthesis and release from melanoma cells. We also tested whether IL-1R signaling affects other cytokines/chemokines known to be associated with melanoma progression (30). When treated with IL-1Ra, 1205Lu cells produced and secreted 90% less IL-6, IL-8, and MCP-1.

Melanoma-derived IL-1β and Its Downstream Mediators Induce IL-1 Production from Macrophages, Mediate Macrophage Recruitment, and Enhance Angiogenesis in Vitro

To define the biological role of melanoma-derived IL-1β and the downstream mediators induced by IL-1β in tumor microenvironment, we generated supernatants (MCM) of 1205Lu cells after 24 h of cultivation. MCM significantly enhanced the production of IL-1β (2.7-fold) and IL-1α (6.9-fold) in THP-1 cells (Fig. 4B). Whereas pretreating 1205Lu cells with IL-1Ra (MCM/IL-1Ra) abolished this effect, adding IL-1Ra to MCM (MCM+IL-1Ra) attenuated but did not abolish the effect, suggesting that not only melanoma-derived IL-1 itself but also the downstream mediators induced by IL-1 mediate the paracrine effect.

We then examined the effect of melanoma-derived IL-1β and its mediators on macrophage chemotaxis. Whereas 1205Lu MCM enhanced chemotaxis of THP-1 cells 2.7-fold, the effect was abolished by pretreating 1205Lu cells with caspase inhibitors (Z-VAD or Z-YVAD) or IL-1R blockade (Fig. 4C). Adding caspase inhibitors or IL-1Ra into MCM showed no direct inhibitory effects on chemotaxis (data not shown).

1205Lu cells secreted IL-8, an enhancer and stimulator of angiogenesis (31, 32). When 1205Lu cells were treated with caspase inhibitors or IL-1Ra, the release of IL-8 was significantly inhibited (55% inhibition by caspase inhibitors and 91% inhibition by IL-1Ra) (Fig. 4D, left panel). HUVECs were also used to determine the effect of MCM on angiogenesis in vitro. Compared with medium alone (control), 1205Lu MCM induced 1.8-fold more tubular structures formed by HUVECs (Fig. 4D, center and right panels). However, tube formation was reduced when 1205Lu cells were pretreated with caspase inhibitors or IL-1R blockade (Fig. 4D, center and right panels). Taken together, these data indicate the biological function of melanoma-derived IL-1β in a paracrine fashion.

IL-1 Stimulates IL-1β Release in Intermediate Stage Human Melanoma Cell Lines

Because early and intermediate stage melanoma cell lines did not secrete IL-1β at base line, we examined the ability of LPS and IL-1 to induce IL-1 release from these cells. The secretion of IL-1β was induced by IL-1α in three VGP melanoma cell lines (WM278, WM75, and WM115) that did not secrete IL-1β at base line (Table 1). On the contrary, the secretion was not induced by IL-1α in RGP melanoma cell lines (WM35 and WM1552C), despite the induction of IL-1β synthesis. LPS showed little or minimal effects on IL-1β synthesis and secretion in melanoma cell lines (data not shown). LDH levels revealed that increased IL-1β release was not the result of increased cell death.

Early and Intermediate Stage Human Melanoma Cell Lines Contain Components of an Active Inflammasome

Because IL-1β secretion was induced by IL-1α in VGP but not RGP melanoma cell lines, we examined the expression of inflammasome components in WM35, an RGP melanoma cell line, and WM115, a VGP melanoma cell line, both of which had undetectable IL-1β synthesis and secretion at base line. Western blotting analysis revealed the expression of inflammasome components in both WM35 and WM115 cells (Fig. 5A). When stimulated with IL-1α, the production of pro-IL-1β (31-kDa form) was induced in WM115 cells, whereas levels of the inflammasome components were unchanged in both cells. Immunoprecipitation revealed co-precipitation of NALP3 with ASC in WM35 and WM115 cells (Fig. 5B). Western blotting of lysates of WM35 and WM115 cells revealed the p20 cleavage products of both caspase-1 and caspase-5 in the absence of IL-1α stimulation (Fig. 5C).

Despite the presence of active NALP3, in early stage melanoma cells (WM35 and WM1552C cells), we did not observe secretion of IL-1β after stimulation with IL-1α (Table 1). Therefore, these cells were stimulated with the combination of IL-1α plus co-stimulant, the nucleotide oligomerization domain 2 activator muramyl dipeptide. The co-stimulation increased the synthesis of the IL-1β precursor production (1.8-fold increase in WM1552C and 1.5-fold increase in WM35) and induced secretion of IL-1β (data not shown). LDH levels in the supernatants were low, confirming that increased IL-1β release was not due to cell death. The data suggest that unlike late stage melanoma, the constitutive NALP3 inflammasome in early stage melanoma requires stimulation with IL-1 plus a second activator to function for the secretion of IL-1β.

Tumor Cells from Clinical Metastatic Melanoma Constitutively Synthesize and Secrete IL-1β

We analyzed IL-1β synthesis and secretion in clinical melanoma tumors. Fifteen surgically obtained human melanoma tumor specimens (five primary and ten metastatic melanoma tumors) were formalin-fixed and paraffin-embedded. Whereas none of the five primary lesions stained for IL-1β, tumor cells from eight of ten metastatic melanomas stained positively for IL-1β (Fig. 6, A and B). Three metastatic melanoma specimens revealed diffuse IL-1β staining in most tumor cells (Fig. 6A, center panel), whereas five metastatic melanoma specimens showed positive staining in 10–30% tumor cells (Fig. 6A, right panel).

We then analyzed the lysates and supernatants of human melanoma tumors. Although three primary melanoma specimens were obtained for the analysis, only one primary melanoma tumor (sample 1) yielded enough cells for further ELISA analysis. Four other samples were obtained from metastatic melanoma tumors (samples 2, 4, 6, and 7). Whereas IL-1β synthesis and secretion were detected in all four metastatic melanoma cells, they were barely detectable in the sample 1 primary melanoma cells (Fig. 6C).

Caspases Are Constitutively Activated in Tumor Cells from Clinical Metastatic Melanoma

To explore the molecular mechanisms responsible for the secretion of IL-1β in clinical metastatic melanoma specimens, we selected two metastatic tumors, samples 2 and 6, for further study. Western blotting analysis revealed activated (cleaved) fragments of caspase-1 (p20) and caspase-5 (p20) in the lysates of human metastatic tumor cells (samples 2 and 6) in the absence of exogenous stimuli (Fig. 6D). These results are in accord with the data from human melanoma cell lines (Figs. 1A and 2C) and confirm our conclusion that constitutively activated caspases mediate secretion of IL-1β in human metastatic melanoma cells.