Table 1. Novel miRNAs identified in hESC.
| Name | Sequence a | Number of clones b | Cloning source library | Comments | Expression in hESC |
| MID246 | ATTTGTGCTTGGCTCTGTCA(C) | 2 | Undifferentiated HES2 | Derived from a highly conserved area. Very stable hairpin. | Downregulated only in HES2 in response to NaB |
| MID363 | CTGTACAGCCTCCTAGCTTTCC | 2 | Brain-Substantia nigra | miR* of hsa-let-7a in hsa-let-7a-2 | Upregulated only in HES1 in response to NaB |
| MID39 | (A)AAATGGTGCCCTAGTGACTAC(A) | 3 | Placenta | miR* of hsa-miR-224. Cloned with variable 5′ and 3′ ends | Upregulated only in HES1 in response to NaB |
a
Nucleotides that were optional during sequencing are in parenthesis.
b
of all variants.