FIG. 2.
Repression of luciferase reporters bearing lin-28 miREs by miR-125a and miR-125b. A. Map of human lin-28 mRNA and duplexes of the lin-28 miREs with miR-125a and miR-125b. In the RNA duplexes, the miRE (top strand) is drawn in a 5′-to-3′ orientation (left to right), and the miRNA (bottom strand) is drawn in a 3′-to-5′ orientation (left to right). These two lin-28 miREs are located directly beside one another, such that the two nucleotides shown at the 3′ end of miRE1 and at the 5′ end of miRE2 are the same two nucleotides of the lin-28 3′ UTR. B. Repression of a luciferase reporter bearing the lin-28 3′ UTR by miR-125a and miR-125b. 293T cells were transiently cotransfected with a luciferase reporter plasmid bearing either the human lin-28 3′ UTR (Luc-lin 28) or the SV40 late 3′ UTR (Luc), together with a plasmid encoding β-galactosidase (an internal standard to control for transfection efficiency) and one of five plasmids encoding either miR-125a or miR-125b, deletion variants thereof, or no miRNA-related transcript (control). Alternatively, the cotransfections were performed using Luc-lin 28 reporters from which miRE1 and/or miRE2 had been deleted. After 36 h, the ratio of luciferase activity to β-galactosidase activity in cell extracts was measured. Error bars correspond to the standard deviation of multiple measurements. C. Repression of a luciferase reporter bearing multiple copies of the lin-28 miREs by miR-125a and miR-125b. 293T cells were transiently cotransfected with a plasmid containing a luciferase-SV40 reporter gene (Luc) that bore 0, 2, 4, or 6 copies of miRE1, miRE2, or lin-28 element X (UGCAAGUGAGGGUUCUGGGGG) in its 3′ UTR and with one of four plasmids encoding miR-125a or miR-125b or deletion variants thereof, together with a plasmid encoding β-galactosidase (internal standard). After 36 h, the ratio of luciferase activity to β-galactosidase activity in cell extracts was measured. The activity ratio for cells transfected with genes encoding miR-125a or miR-125b was then normalized to the ratio in cells transfected with the corresponding deletion mutant that did not encode an miRNA and graphed.